I have a GRanges object:

library(GenomicRanges)

gr <- new("GRanges",
  seqnames = new("Rle",
    values = structure(1L, .Label = "chr8", class = "factor"),
    lengths = 8L, elementMetadata = NULL, metadata = list()
  ),
  ranges = new("IRanges",
    start = c(
      1L, 1L, 3L, 2L, 51L, 51L,
      55L, 42L
    ), width = c(50L, 36L, 27L, 24L, 28L, 25L, 24L, 19L), NAMES = NULL, elementType = "ANY", elementMetadata = NULL,
    metadata = list()
  ), strand = new("Rle",
    values = structure(3L, .Label = c(
      " ",
      "-", "*"
    ), class = "factor"), lengths = 8L, elementMetadata = NULL,
    metadata = list()
  ), seqinfo = new("Seqinfo",
    seqnames = "chr8",
    seqlengths = NA_integer_, is_circular = NA, genome = NA_character_
  ),
  elementMetadata = new("DataFrame",
    rownames = NULL, nrows = 8L,
    listData = list(abundance = c(
      101, 9982, 59, 310, 109,
      478, 89, 403
    ), seq = c(
      "GCCCGGCGTCCGTGGCCTTTGATCAAGGGCTTCCCTTTGCGAAAGCGCAT",
      "TTGAGTTTACAGACTTTCTGCAATTTGGACGCCTGT",
      "TCTAGTGCGAATATGGCTGGCCGTGAT",
      "GTAAGCTGGCGGCCAGAATCCGGG",
      "CGGCGCGGCAAGAACAACACGCGGTTCG",
      "CCTGCCATCTGGCGAGTTCGGGACA",
      "ACTTCGTGTGCGTTGGTTACTGAT",
      "GCAAACGATGGATACAAGC"
    )),
    elementType = "ANY", elementMetadata = NULL,
    metadata = list()
  ), elementType = "ANY", metadata = list()
)

It look like:

GRanges object with 8 ranges and 2 metadata columns:
      seqnames    ranges strand | abundance                    seq
         <Rle> <IRanges>  <Rle> | <numeric>            <character>
  [1]     chr8      1-50      * |       101 GCCCGGCGTCCGTGGCCTTT..
  [2]     chr8      1-36      * |      9982 TTGAGTTTACAGACTTTCTG..
  [3]     chr8      3-29      * |        59 TCTAGTGCGAATATGGCTGG..
  [4]     chr8      2-25      * |       310 GTAAGCTGGCGGCCAGAATC..
  [5]     chr8     51-78      * |       109 CGGCGCGGCAAGAACAACAC..
  [6]     chr8     51-75      * |       478 CCTGCCATCTGGCGAGTTCG..
  [7]     chr8     55-78      * |        89 ACTTCGTGTGCGTTGGTTAC..
  [8]     chr8     42-60      * |       403    GCAAACGATGGATACAAGC
  -------
  seqinfo: 1 sequence from an unspecified genome; no seqlengths

Plot I can make

library(ggbio)
autoplot(gr, aes(fill = abundance))

Question

How can I display the nucleotide sequences instead of the rectangles, with each nucleotide coloured differently?

CodePudding user response：

I personally find ggbio cumbersome to plot with, so my suggestion is to convert basepair-wise observations to a dataframe and then plot that.

library(GenomicRanges)
library(ggplot2)

# gr <- new("GRanges", ...) # omitted for brevity

# Make row for every letter
df <- mapply(function(s, e, seq, i) {
  data.frame(
    pos = seq(s, e, by = 1L),
    seq = seq,
    id = i
  )
}, s = start(gr), e = end(gr), seq = strsplit(gr$seq, ""), i = seq_along(gr),
SIMPLIFY = FALSE)
# Combine different granges
df <- do.call(rbind, df)

# Determine y-position in plot
offset <- disjointBins(gr)
df$offset <- offset[df$id]

# Plot
ggplot(df, aes(pos, offset, fill = seq))  
  geom_tile(height = 0.8)

^{Created on 2021-10-11 by the reprex package (v2.0.0)}