I was trying to an take RNA sequence as input and get its respective codons as output.
For example:
Input: AUGGGAACUUCACUACGUAAAUAG
Output: Codons are: AUG, GGA, ACU, UCA, CUA, CGU, AAA, UAG
I coded like this in Python 3.8:
rna = input("Enter the RNA sequence:")
list1 = []
rna = list(rna)
for i in range(len(rna)):
list2 = []
list2.append(rna[i : i 3 : 3])
liststr = "".join(list2)
list1.append(liststr)
print(list1)
But, I am getting the error TypeError: sequence item 0: expected str instance, list found
. What is the issue with this code?
CodePudding user response:
You're overcomplicating things. You just need to maintain one list, and walk through the string three characters at a time. There's no need to transform a string into a list, or vice versa.
rna = input("Enter the RNA sequence:")
result = []
for i in range(0, len(rna), 3):
result.append(rna[i:i 3])
print(result)
With the sample input, this produces:
['AUG', 'GGA', 'ACU', 'UCA', 'CUA', 'CGU', 'AAA', 'UAG']
CodePudding user response:
In your code, list2
is a list of lists.
But str.join
doesn't work on lists of lists. Consider a minimal example:
>>> a = [[1, 2, 3], [4, 5, 6]]
>>> ''.join(a)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
TypeError: sequence item 0: expected str instance, list found
You need to join each list into a string. Something like:
list2 = [''.join(lst) for lst in list2]