TypeError: sequence item 0: expected str instance, list found in python 3-CodePudding

I was trying to an take RNA sequence as input and get its respective codons as output.

For example:

Input: AUGGGAACUUCACUACGUAAAUAG

Output: Codons are: AUG, GGA, ACU, UCA, CUA, CGU, AAA, UAG

I coded like this in Python 3.8:

rna = input("Enter the RNA sequence:")
list1 = []
rna = list(rna)

for i in range(len(rna)):
    list2 = []
    list2.append(rna[i : i   3 : 3])
    liststr = "".join(list2)
    list1.append(liststr)

 print(list1)

But, I am getting the error TypeError: sequence item 0: expected str instance, list found. What is the issue with this code?

CodePudding user response：

You're overcomplicating things. You just need to maintain one list, and walk through the string three characters at a time. There's no need to transform a string into a list, or vice versa.

rna = input("Enter the RNA sequence:")
result = []
for i in range(0, len(rna), 3):
    result.append(rna[i:i 3])
print(result)

With the sample input, this produces:

['AUG', 'GGA', 'ACU', 'UCA', 'CUA', 'CGU', 'AAA', 'UAG']

CodePudding user response：

In your code, list2 is a list of lists.

But str.join doesn't work on lists of lists. Consider a minimal example:

>>> a = [[1, 2, 3], [4, 5, 6]]
>>> ''.join(a)
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
TypeError: sequence item 0: expected str instance, list found

You need to join each list into a string. Something like:

list2 = [''.join(lst) for lst in list2]