How can I extract a portion of text from all lines of a file?-CodePudding

I have these sequences:

0,<|endoftext|>ERRDLLRFKH:GAGCGCCGCGACCTGTTACGATTTAAACAC<|endoftext|>
1,<|endoftext|>RRDLLRFKHG:CGCCGCGACCTGTTACGATTTAAACACGGC<|endoftext|>
2,<|endoftext|>RDLLRFKHGD:CGCGACCTGTTACGATTTAAACACGGCGAC<|endoftext|>
3,<|endoftext|>DLLRFKHGDS:GACCTGTTACGATTTAAACACGGCGACAGT<|endoftext|>

And I'd like to get only the aminoacid sequences, like this:

ERRDLLRFKH:
RRDLLRFKHG:
RDLLRFKHGD:
DLLRFKHGDS:

I have wrote this script so far:

with open("example_val.txt") as f:
    for line in f:
        if line.startswith(""):
            line = line[:-1]
        print(line.split(":", 1))

Nevertheless, I got only the original sequences. Please give me some advice.

CodePudding user response：

Regex solution:

import re

with open("example_val.txt") as f:
    re.findall("(?<=>)[a-zA-Z]*:", f.read())

Regex Explanation:

(?<=>) : is a positive lookbehind which finds the > character before our match
[a-zA-Z]*: : matches zero or more of characters present in a-z and A-Z with the colon at the end

Test in Regex101 : regex101.com/r/qVGCYF/1

CodePudding user response：

First, remember that storing something (e.g. in a list) is not the same as printing it -- if you need to use it later, you need to store all your amino acid sequences in a list when you parse your file. If you just want to display them and do nothing else, it's fine to print.

You have a bunch of ways to do this:

Use a regular expression with a lookbehind like johann's answer
Use a CSV reader to isolate just the second column of your comma-separated text file, and then slice the string, since you know the value you want starts at the 13th index and ends at the 23rd index

import csv

sequences = []  # Create an empty list to contain all sequences

with open("example_val.txt") as f:
    reader = csv.reader(f)
    for row in reader:
        element = row[1]      # Get the second element in the row
        seq = element[13:24]  # Slice the element
        sequences.append(seq) # Append to the list
        print(seq)            # Or print the current sequence

Find the index of <|endoftext|> in the string. Relative to this index i, you know that your sequence starts at the index i len('<|endoftext|>'), and ends at i len('<|endoftext|>') 10

with open("example_val.txt") as f:
    for line in f:
        i = line.find('<|endoftext|>')
        seq_start = i   len('<|endoftext|>')
        seq_end = seq_start   10
        seq = line[seq_start:seq_end 1]  # Slice the line
        sequences.append(seq)            # Append to the list
        print(seq)                       # Or print the current sequence