Python- adding up the elements in for loop based on dictionary-CodePudding

What should I add or change to my code below in order to get a function that finds the mean length of reads??? I have to write a function, mean_length, that takes one argument: A dictionary, in which keys are read names and values are read sequences. The function must return a float, which is the average length of the sequence reads. Hope someone can help me :D I am very new to coding in python.

read_map = {'Read1': 'GGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTCGTCCAGACCCCTAGC',
'Read3': 'GTCTTCAGTAGAAAATTGTTTTTTTCTTCCAAGAGGTCGGAGTCGTGAACACATCAGT',
'Read2': 'CTTTACCCGGAAGAGCGGGACGCTGCCCTGCGCGATTCCAGGCTCCCCACGGG',
'Read5': 'CGATTCCAGGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTC',
'Read4': 'TGCGAGGGAAGTGAAGTATTTGACCCTTTACCCGGAAGAGCG',
'Read6': 'TGACAGTAGATCTCGTCCAGACCCCTAGCTGGTACGTCTTCAGTAGAAAATTGTTTTTTTCTTCCAAGAGGTCGGAGT'}

def mean_lenght (read_map):
    print('keys : ',read_map.values())
    for key in read_map.keys():
        print(key) 
    #result = sum(...?)/len(read_map)
    return result
print(mean_lenght(read_map))

CodePudding user response：

A very one-line simple solution could be:

def mean_length(read_map):
    return sum([len(v) for v in read_map.values()]) / len(read_map)

Basically, you construct a list of elements, each storing the length of an entry of read_map. Then, you sum up all those lengths and divide by the number of entries in your dict.

If your dictionary is very big, then constructing a list might not be the most memory efficient way. In this case:

def mean_length(read_map):
    mean = 0
    for v in read_map.values(): mean  = len(v)
    mean /= len(read_map)
    return mean

In this way, you do not build any intermediate list.

CodePudding user response：

The mean is the sum of lengths divided by the number of values, so let's just do this:

sum(map(len, read_map.values()))/len(read_map)

output: 55.333

Breakdown:

# "…" denotes the output of the previous line
read_map.values()  ->  returns the values of the dictionary
map(len, …)  -> computes the length of each sequence
sum(…)  -> get the total length
sum(…)/len(read_map)  -> divide the total length by the number of sequence = mean

As a function:

def mean_length(d):
    return sum(map(len, d.values()))/len(d)

>>> mean_length(read_map)
53.33

CodePudding user response：

get a function that finds the mean length of reads???

python built-in module statistics has what you are looking for statistics.mean. Naturally you need to find lengths before feeding data in said function, for which len built-in function is useful.

import statistics
read_map = {'Read1': 'GGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTCGTCCAGACCCCTAGC',
'Read3': 'GTCTTCAGTAGAAAATTGTTTTTTTCTTCCAAGAGGTCGGAGTCGTGAACACATCAGT',
'Read2': 'CTTTACCCGGAAGAGCGGGACGCTGCCCTGCGCGATTCCAGGCTCCCCACGGG',
'Read5': 'CGATTCCAGGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTC',
'Read4': 'TGCGAGGGAAGTGAAGTATTTGACCCTTTACCCGGAAGAGCG',
'Read6': 'TGACAGTAGATCTCGTCCAGACCCCTAGCTGGTACGTCTTCAGTAGAAAATTGTTTTTTTCTTCCAAGAGGTCGGAGT'}
print(statistics.mean(len(v) for v in read_map.values()))

output

55.333333333333336

CodePudding user response：

def mean_length(read_map):
    total_chars = 0
    for key in read_map.values():
        total_chars = total_chars   len(key)
    result = total_chars / len(read_map)
    return result

I think this is the most intuitive code for beginner.